Search and filter

Search and filter results by custom parameters

Results

Study Condition Condition description Gene RVIS Variant identifier (dbSNP or HGVS) Reference allele Alternate allele Variant type P-value Odds ratio
Gibson et al., 2008 CP Diplegia NOS3 -1.10 rs1800779 G A SNV 0.03000000 0.500
Mei et al., 2021 CP None KCNQ2 -0.67 NM_172107.4:c.1527delA CT C DEL None None
Esih et al., 2021 NESHIE Normal magnetic resonance imaging presentation CAT -0.31 rs1001179 C T SNV 0.03400000 0.390
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.724-8G>A G A SNV None None
Wang et al., 2024 CP None KIF1A -3.67 rs1057518226 C T SNV None None
Harteman et al., 2013 NESHIE White matter/watershed brain injury MTHFR 0.09 rs1801133 G A SNV <0.05000000 3.700
Wu et al., 2009 CP None IL6 0.73 rs1800795 C G SNV 0.03000000 1.400
van Eyk et al., 2019 CP Spastic hemiplegia, possible periventricular leukomalacia KANK1 -0.92 NM_153186.5:c.2515G>C G C SNV None None
Wu et al., 2009 CP None IL6 0.73 rs1800795 C G SNV 0.00100000 2.600
Wang et al., 2024 CP None CDKL5 -0.67 rs61753251 CT - DEL None None
Gibson et al., 2008 CP Diplegia NOS3 -1.10 rs1800779 G A SNV 0.03000000 0.660
Wang et al., 2024 CP None DUOX2 0.23 rs147540920 C A SNV None None
Thys et al., 2024 CP Spastic diplegia, Intellectual disability, Developmental disorder KIF1A -3.67 rs1553638086 G A SNV None None
Wang et al., 2024 CP None GNAO1 -0.74 rs539662922 C T SNV None None
van Eyk et al., 2019 CP NESHIE; spastic quadriplegia, dykinesia, seizures, diagnosed neonatal encephalopathy KANK1 -0.92 NM_153186.5:c.2584G>A G A SNV None None
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.3977G>T C A SNV None None
Gabriel et al., 2016 NESHIE Reduced periventricular leukomalacia risk TNF -0.03 rs1799964 T C SNV 0.04400000 0.408
Jin et al., 2020 CP None NR1I2 -0.55 NM_022002.2:c.1172-1G>T G T Splicing None None
van Eyk et al., 2019 CP Developmental delay, epilepsy KANK1 -0.92 NM_153186.5:c.316C>T C T SNV None None
Thys et al., 2024 CP Epileptic encephalopathy, dystonia, feeding difficulties, Developmental disorder, Intellectual disability KCNQ2 -0.67 NM_172107.4:c.881C>T G A SNV None None
Pingel et al., 2018 CP None COL4A1 -2.82 NM_001845.4:c.3607C>G G C SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1800896 T C SNV 0.00600000 2.881
Thys et al., 2024 CP Developmental disorder, epilepsy, spastic diplegia KIF1A -3.67 rs548204329 G A SNV None None
Woodward et al., 2023 NESHIE Cystic fibrosis confirmed in patient following genetic testing CFTR -0.51 rs78655421 G A SNV None None
van Eyk et al., 2019 CP Spastic/dystonic diplegia, neonatal encephalopathy, developmental delay, seizure, cerebral oedema KANK1 -0.92 NM_153186.5:c.2398G>A G A SNV None None
Moreno-De-Luca et al., 2021 CP None PTPN11 -0.43 NM_002834.5:c.1387A>G A G SNV None None
Gibson et al., 2006 CP Quadriplegia, gestational age >= 37 weeks TNF -0.03 rs1800629 G A SNV 0.02000000 1.820
Bi et al., 2014 CP None IL6 0.73 rs2069832 A G SNV 0.02000000 2.700
Hou et al., 2016 CP TNF-a levels TNF -0.03 rs361525 G A SNV <0.05000000 None
Esih et al., 2021 NESHIE Less white matter damage IL1B -0.38 rs1071676 C G SNV 0.01100000 0.180
Kuzmanic Samija et al., 2014 NESHIE Abnormal magnetic resonance imaging NOS3 -1.10 rs1808593 G T SNV 0.01040000 6.572
Khankhanian et al., 2013 CP None IL6 0.73 rs1800795 C G SNV 0.03000000 2.500
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1800871 A G SNV 0.00300000 0.549
Bi et al., 2014 CP Male, Spastic IL6 0.73 rs2066992 G T SNV 0.04100000 None
Xia et al., 2018 CP None IL10 0.04 rs3024490 A T SNV 0.03300000 0.702
McMichael et al., 2015 CP Hemiplegia, epilepsy KANK1 -0.92 NM_153186:c.243C>G C G SNV None None
Bi et al., 2016 CP None COL4A1 -2.82 rs1961495 C T SNV 0.04670000 1.387
Gabriel et al., 2016 NESHIE Reduced periventricular leukomalacia risk IL10 0.04 rs1800896 T C SNV <0.00010000 0.074
Mei et al., 2021 CP None SCN1A -1.43 NM_001165963.4:c.4112G>A C T SNV None None
Mei et al., 2021 CP None KCNQ2 -0.67 NM_172107.4:c.172C>A G T SNV None None
Thys et al., 2024 CP Spastic quadriplegia, lesional epilepsy, Developmental disorder, Intellectual disability, dysarthria. Father was later diagnosed with microscopic hematuria, otherwise asymptomatic. COL4A1 -2.82 NM_001845.6:c.1728_1738delinsCCAAGGG - TACAGAACCCTGATGTGAGAAGAAGAAAAAGACACCGTTATCAGAGACACACCAACACCCTGTCCTTATCGCATTCTTCTGACATTTGTGGTCAATAAGTACTAGAGTTAACTGGCTCACACTATTTATTTACTTCATCTACCCTCCCAGGAGGGCCACCTTGTAGTTAATAAGTGAAACCAGCATTCTTCTCCCTAAGCTGAGCATTCTTCCTCCCTCATCTACTTAGGGAGATACTTTAGAGAATGAGATGTTGATACCTGGAATCTTTTGAAAACAATGACATGAATACTATTAACTTTAGATTTCACCTCCCATCCAAAGCAAAAAGATACACAAACACATCTGTTCAGTTCCCCCAAATGCATCAGAAGACACTGATCTGTTATCACCTAATTATTTGTCAATAATAACTGGCAATGCCTAGGTTTATAGACTTAAGTTGTTCCATGAACCATGAATCATGAAACAAGTTCATTTGTGCCATCATCAAGGAGATAGAAATACATCAATATGATTCAAATTACTCATTTCTCAATGCTTTGCAGATCCACACTGTAAAATGCACATTCAAAGTCTGGAGATAAACATACC:CCTTGG INS None None
Gibson et al., 2008 CP Girls MTHFR 0.09 rs1801133 G A SNV 0.00900000 1.740
van Eyk et al., 2019 CP NESHIE; dyskinetic mixed diplegia, seizures NR1I2 -0.55 NM_003889.3:c.1087G>A G A SNV None None
Wang et al., 2024 CP None PHIP -1.24 rs771126523 TTTAT - DEL None None
van Eyk et al., 2019 CP Spastic hemiplegia COL4A1 -2.82 NM_001845.6:c.4516A>G T C SNV None None
van Eyk et al., 2019 CP Spastic hemiplegia, possible periventricular leukomalacia KANK1 -0.92 NM_153186.5:c.2515G>C G C SNV None None
van Eyk et al., 2021 CP NESHIE; spastic quadriplegia, dykinesia, seizures COL4A4 1.04 NM_000092.5:c.4720C>T G A SNV None None
Parobek et al., 2024 NESHIE None ACTA1 -0.30 rs1659975786 C T SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1800871 A G SNV 0.01200000 None
Kuzmanic Samija et al., 2011 NESHIE None NOS3 -1.10 rs1808593 G T SNV 0.00800000 9.625
May et al., 2021 CP Birth asphyxia; generalised dystonia, spastic bilateral CP PANK2 -0.23 NM_153638.3:c.1412+1G>C G C SNV None None
Gibson et al., 2005 CP Protective for diplegia, 32-36 weeks gestation MTHFR 0.09 rs1801131 T G SNV <0.05000000 0.160
van Eyk et al., 2019 CP Spastic/dystonic quadriplegia KANK1 -0.92 NM_153186.5:c.3005G>A G A SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1518111 T C SNV 0.00900000 1.696
Bi et al., 2014 CP Male, Spastic IL6 0.73 rs2069837 A G SNV 0.02100000 None
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.736G>A G A SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs1553639011 T G SNV None None
Wang et al., 2024 CP None KIF1A -3.67 NM_001244008.1:c.2977+2T>C A G SNV None None
Wang et al., 2024 CP None DUOX2 0.23 NM_001363711.2:c.2202G>A C T SNV None None
Wu et al., 2011 CP None IL6 0.73 rs1800795 C G SNV <0.00100000 2.170
Gibson et al., 2008 CP Diplegia NOS3 -1.10 rs1800779 G A SNV 0.03000000 0.660
Gabriel et al., 2016 NESHIE Periventricular leukomalacia IL10 0.04 rs1800896 T C SNV <0.00010000 13.500
Wang et al., 2024 CP None KIF1A -3.67 rs879253888 G A SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1554286 A T SNV 0.01500000 0.612
Woodward et al., 2023 NESHIE None ISY1 -0.10 ISY1:c.607+G>A None None None None None
Woodward et al., 2023 NESHIE Congenital adrenal hypoplasia confirmed in patient following genetic testing CYP21A2 None rs6471 G C SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs876661202 G C SNV None None
Mei et al., 2021 CP None KCNQ2 -0.67 rs587777219 G A SNV None None
Almansa et al., 2024 CP None COL4A1 -2.82 rs2139156247 C T SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs3024490 A T SNV 0.00600000 0.573
Mei et al., 2021 CP None DUOX2 0.23 rs181461079 C A SNV None None
van Eyk et al., 2021 CP Spastic hemiplegia, epilepsy, developmental delay GNAO1 -0.74 NM_138736.3:c.951A>C A C SNV None None
van Eyk et al., 2019 CP Choreoathetoid quadriplegia, cystic porencephaly, damage to small blood vessels with increased risk of haemorrhage, epileptic encephalopathy, seizure, developmental delay COL4A1 -2.82 NM_001845.6:c.2494G>A C T SNV None None
Thys et al., 2024 CP Spastic diplegia, Developmental disorder, epilepsy, Autism spectrum disorder KIF1A -3.67 rs797045655 G A SNV None None
Zhu et al., 2018 CP None KCNQ2 -0.67 rs201750561 C A SNV None None
Thys et al., 2024 CP Spastic hemiplegia, Developmental disorder, Intellectual disability ventricular septum defect, laryngomalacia, feeding problems, microphtalmia, microcornea COL4A1 -2.82 rs1555303010 C T SNV None None
Pavlov, et al., 2023 NESHIE None SERPINB2 0.20 rs6103 C G SNV 0.01300000 3.800
Hou et al., 2016 CP None MTHFR 0.09 rs9651118 T C SNV <0.00100000 None
Moreno-De-Luca et al., 2021 CP None SMARCB1 -0.34 NM_00307:c.110G>A None None SNV None None
Gibson et al., 2008 CP Diplegia NOS3 -1.10 rs1800779 G A SNV 0.03000000 0.500
Wang et al., 2013 CP NESHIE AP4B1 -0.13 rs1217401 A G SNV 0.04220000 0.470
Cheng et al., 2011 CP Mental retardation MTHFR 0.09 rs1476413 C T SNV 0.02800000 None
Cheng et al., 2011 CP Mental retardation MTHFR 0.09 rs4846049 T G SNV 0.03100000 None
Moreno-De-Luca et al., 2021 CP None MTFMT 0.71 rs201431517 G A SNV None None
Gibson et al., 2005 CP Diplegia, < 32 weeks gestation MTHFR 0.09 rs1801133 G A SNV <0.05000000 2.760
Woodward et al., 2023 NESHIE None MTFMT 0.71 rs200286768 G A SNV None None
van Eyk et al., 2019 CP Female, spastic/dystonic diplegia, more dystonic than spastic with intermittent hypertonicity, born 35 weeks, BW: 10th percentile, SGA, microcephaly, developmental disorders and cortical visual impairment, MRI and X-Ray: Non-specific hyperintensity within the posterior parietal deep white matter, and in the cerebelli, posterior to the dentate nuclei. Bilateral cortical heterotopia in the inferior occipital horns. KIF1A -3.67 rs672601370 G A SNV None None
Parobek et al., 2024 NESHIE None GBE1 0.62 rs552094593 G A SNV None None
Bi et al., 2014 CP Male, Spastic IL6 0.73 rs1800796 G C SNV 0.02200000 None
van Eyk et al., 2019 CP NESHIE; spastic quadriplegia, dykinesia, seizures, diagnosed neonatal encephalopathy DYNC2H1 -0.35 NM_001080463.1:c.3794G>A G A SNV None None
Esih et al., 2021 NESHIE Basal ganglia damage IL1B -0.38 rs1143623 C G SNV 0.03900000 3.960
Fehlings et al., 2024 CP Spastic hemiplegic CP with evidence of IVH/periventricular haemorrhagic infarction on MRI, toxic exposure COL4A1 -2.82 rs1594566006 A - DEL None None
Gibson et al., 2005 CP Protective for quadriplegia MTHFR 0.09 rs1801131 T G SNV <0.05000000 0.330
Wu et al., 2016 NESHIE None NOS3 -1.10 rs2070744 C T SNV 0.00900000 8.795
van Eyk et al., 2019 CP Spastic quadriplegia DYNC2H1 -0.35 NM_001377.3:c.9968C>G C G SNV None None
Fehlings et al., 2024 CP Unspecified CP Subtype, Down Syndrome, normal MRI, congenital malformation, prenatal growth restriction, intrapartum birth asphyxia, intrauterine infection, multiple fetuses, prolonged preterm premature rupture of membrane, family history of CP, prematurity PHIP -1.24 NM_017934.7:c.2514_2517dup G GCCAT DUP None None
May et al., 2021 CP Birth asphyxia; spastic SMARCB1 -0.34 NM_003073.5:c.1121G>A G A SNV None None
van Eyk et al., 2019 CP Developmental delay, epilepsy KANK1 -0.92 NM_153186.5:c.316C>T C T SNV None None
Esih et al., 2016 CP NESHIE CAT -0.31 rs1001179 C T SNV 0.02600000 3.360
Esih et al., 2021 NESHIE posterior limb of internal capsule damage IL1B -0.38 rs1143623 C G SNV 0.00900000 5.670
Wang et al., 2024 CP None COL4A1 -2.82 rs1877827904 G A SNV None None
Esih et al., 2021 NESHIE Protective against moderate/severe magnetic resonance imaging presentation CARD8 1.18 rs2043211 A T SNV 0.04000000 0.260
van Eyk et al., 2019 CP Spastic hemiplegia NR1I2 -0.55 NM_033013.2:c.944-1G>T G T Splicing None None
Bi et al., 2014 CP Male IL6 0.73 rs2069837 A G SNV 0.02700000 1.334
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.3611G>A C T SNV None None
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.2373_2383del ACCCCACGGAG - SNV None None
Moreno-De-Luca et al., 2021 CP None PHIP -1.24 NM_017934.7:c.600+1G>- None None None None None
Wu et al., 2009 CP Controlling for race; clinical chorioamnionitis IL6 0.73 rs1800795 C G SNV <0.00010000 4.600
Thys et al., 2024 CP Spastic diplegia, Autism spectrum disorder, Attention deficit hyperactivity disorder, Developmental disorder, Intellectual disability. Father was similarly affected. KIF1A -3.67 rs1057518760 C T SNV None None
Parobek et al., 2024 NESHIE None DUOX2 0.23 rs181461079 C A SNV None None
Pingel et al., 2018 CP None COL4A4 1.04 rs13027659 C T SNV None None
van Eyk et al., 2021 CP NESHIE; spastic quadriplegia, dykinesia, seizures COL4A4 1.04 NM_000092.5: c.4720C>T G A SNV None None
Fehlings et al., 2024 CP Hemiplegic CP with predominant white matter injury on MRI, intrauterine infection, intrapartum birth asphyxia, maternal illness (Crohn's disease, low iron levels during pregnancy, neonatal encephalopathy), Other: meconium aspiration syndrome, persistent pulmonary hypertension, neonatal abstinence syndrome ZDHHC9 -0.12 NM_001008222.3:c.881+1G>T C A SNV None None
Fehlings et al., 2024 CP Right spastic hemiplegia, MRI shows basal ganglia and thalamus lesion with cortico-subcortical injury and focal porencephaly, congenital malformation, maternal illness: lupus, intrauterine growth restriction, placental abnormality (multiple clots) COL4A1 -2.82 rs672601347 C G SNV None None
Bi et al., 2014 CP Male, Spastic IL6 0.73 rs2066992 G T SNV 0.04000000 None
Bi et al., 2014 CP Male IL6 0.73 rs2069837 A G SNV 0.04100000 None
Esih et al., 2021 NESHIE Protective against severe magnetic resonance imaging presentation CARD8 1.18 rs2043211 A T SNV 0.04800000 None
Wu et al., 2009 CP None IL6 0.73 rs1800795 C G SNV 0.03000000 1.400
Thys et al., 2024 CP Developmental disorder, Intellectual disability, spastic diplegia, Attention deficit hyperactivity disorder KIF1A -3.67 rs1064795534 C T SNV None None
Wang et al., 2024 CP None KCNQ2 -0.67 NM_172107.4:c.881C>T G A SNV None None
Chopra et al., 2022 CP Spastic diplegic, cryptogenic (no predefined risk factors) GNAO1 -0.74 NM_020988.2:c.625C>T C T SNV None None
Torres-Merino et al., 2019 CP NESHIE IL1B -0.38 rs16944 A G SNV 0.01890000 2.633
Wu et al., 2009 CP Controlling for race IL6 0.73 rs1800795 C G SNV 0.00400000 2.400
Xia et al., 2018 CP None IL10 0.04 rs1800896 T C SNV 0.03300000 0.696
Hou et al., 2016 CP None TNF -0.03 rs361525 G A SNV 0.01000000 None
Bi et al., 2016 CP Males COL4A1 -2.82 rs1411040 C T SNV 0.03400000 2.042
van Eyk et al., 2019 CP None KANK1 -0.92 NM_153186.5:c.3569G>A G A SNV None None
Pingel et al., 2018 CP None COL4A1 -2.82 rs34004222 G A SNV None None
Bi et al., 2014 CP Male, Spastic IL6 0.73 rs1800796 G C SNV 0.02700000 None
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.625C>T C T SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs797045164 G A SNV None None
Wang et al., 2024 CP None COL4A1 -2.82 NM_001845.6:c.2147del CG C DEL None None
Bi et al., 2014 CP None IL6 0.73 rs2069845 G A SNV 0.09000000 2.300
Wang et al., 2024 CP None KCNQ2 -0.67 rs796052622 A G SNV None None
Wang et al., 2024 CP None KCNQ2 -0.67 rs397515420 T C SNV None None
van Eyk et al., 2019 CP Spastic quadriplegia with generalised hypotonia, dystonic posture, intellectual disability, epilepsy, periventricular leukomalacia COL4A1 -2.82 NM_001845.6:c.2413G>A C T SNV None None
Parobek et al., 2024 NESHIE None DUOX2 0.23 NM_014080.4:c.3616G>A C T SNV None None
Gabriel et al., 2016 NESHIE Periventricular leukomalacia IL10 0.04 rs1800896 T C SNV 0.03000000 1.962
Moreno-De-Luca et al., 2021 CP None CDKL5 -0.67 rs267608395 C T SNV None None
Bi et al., 2014 CP Male, Spastic IL6 0.73 rs2069837 A G SNV 0.02400000 None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs1064793161 C T SNV None None
Wu et al., 2009 CP Controlling for race; maternal age >= 35 IL6 0.73 rs1800795 C G SNV <0.00010000 2.500
McMichael et al., 2015 CP None ZDHHC9 -0.12 rs1177392425 C T SNV None None
Wang et al., 2024 CP None SCN1A -1.43 rs1057521746 G T SNV None None
Moreno-De-Luca et al., 2021 CP None SCN1A -1.43 NM_001165963:c.4172A>G T C SNV None None
Wang et al., 2013 CP NESHIE AP4B1 -0.13 rs1217401 A G SNV 0.00000446 None
Thys et al., 2024 CP Spastic quadriplegia, epilepsy, language developmental delay, dysarthria. Mother presented with hemorrhagic stroke at age <40y, leading to genetic testing in child. COL4A1 -2.82 NM_001845.6:c.1466-1G>A C T SNV None None
Fehlings et al., 2024 CP Dystonic CP and basal ganglia/thalamus lesions with cortical-subcortical lesion on MRI, intrauterine growth restriction, hyperbilirubinemia (high-intermediate risk level), neonatal hypoglycemia COL4A1 -2.82 rs2139162955 C T SNV None None
van Eyk et al., 2019 CP Developmental delay KANK1 -0.92 NM_153186.5:c.3290C>T C T SNV None None
van Eyk et al., 2019 CP Spastic hemiplegia EIF4E2 -0.34 NM_001276337.1:c.277C>T C T SNV None None
Bi et al., 2014 CP Premature rupture of membrane IL6 0.73 rs2066992 G T SNV 0.01500000 None
Almansa et al., 2024 CP None COL4A1 -2.82 NM_001845.4:c.443G>A C T SNV None None
van Eyk et al., 2019 CP Spastic diplegia, neonatal seizures, developmental delay COL4A1 -2.82 NM_001845.6:c.2447C>T G A SNV None None
Gibson et al., 2005 CP 32-36 weeks gestation MTHFR 0.09 rs1801133 G A SNV <0.05000000 1.910
Gibson et al., 2008 CP Girls MTHFR 0.09 rs1801133 G A SNV 0.02000000 1.630
Mei et al., 2021 CP None KCNQ2 -0.67 rs118192203 G A SNV None None
Harteman et al., 2013 NESHIE White matter/watershed brain injury MTHFR 0.09 rs1801133 G A SNV <0.05000000 9.900
van Eyk et al., 2019 CP Spastic hemiplegia, neonatal lung disease, developmental delay, mild periventricular leukomalacia COL4A1 -2.82 NM_001845.6:c.4856G>A C T SNV None None
van Eyk et al., 2019 CP Developmental delay KANK1 -0.92 NM_153186.5:c.3290C>T C T SNV None None
Parobek et al., 2024 NESHIE None KIF1A -3.67 rs672601369 C T SNV None None
Bi et al., 2014 CP None IL6 0.73 rs2069833 C T SNV 0.05000000 2.400
van Eyk et al., 2019 CP Spastic hemiplegia, possible periventricular leukomalacia DYNC2H1 -0.35 NM_001080463:c.G5158A G A SNV None None
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.3371G>A C T SNV None None
Mei et al., 2021 CP None KCNQ2 -0.67 rs772800738 T A SNV None None
Wang et al., 2024 CP None GNAO1 -0.74 NM_020988.3:c.164T>A T A SNV None None
van Eyk et al., 2019 CP KANK1 -0.92 NM_153186.5:c.3569G>A G A SNV None None
van Eyk et al., 2019 CP Spastic diplegia, seizures, periventricular leukomalacia EIF4E2 -0.34 NM_001276336.1:c.214C>G C G SNV None None
van Eyk et al., 2021 CP None CFTR -0.51 rs113993960 CTT - DEL None None
van Eyk et al., 2019 CP Female, born 40 weeks, father’s second cousin CP, asthma and eczema. KIF1A -3.67 rs375509312 G A SNV None None
Vasconcellos et al., 2023 CP Progressive gait disorder and generalised involuntary movement GNAO1 -0.74 rs1085307876 G A SNV None None
Moreno-De-Luca et al., 2021 CP None SCN1A -1.43 NM_001165963:c.4547C>A G T SNV None None
Hou et al., 2016 CP None MTHFR 0.09 rs9651118 T C SNV 0.00200000 None
Bi et al., 2014 CP None IL6 0.73 rs1554606 T G SNV 0.00700000 2.500
Kuzmanic Samija et al., 2014 NESHIE Moderate and severe brain injury NOS3 -1.10 rs1808593 G T SNV 0.01500000 12.360
Wu et al., 2016 NESHIE Apgar scores NOS3 -1.10 rs2070744 C T SNV 0.00600000 22.206
van Eyk et al., 2019 CP None DYNC2H1 -0.35 NM_001080463.1:c.5492A>G A G SNV None None
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.724-8G>A G A SNV None None
Kremer and Grosso, 2004 NESHIE Associated with increased levels of plasma homocysteine after methionine loading in mothers of CP patients MTHFR 0.09 rs1801133 G A SNV <0.05000000 None
Fehlings et al., 2024 CP Spastic quadriplegia with periventricular haemorrhagic infarction on MRI, congenital malformation, intrauterine growth restriction, intrapartum birth asphyxia COL4A1 -2.82 NM_001845.6:c.1537-1G>A C T SNV None None
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.626G>A G A SNV None None
Esih et al., 2021 NESHIE posterior limb of internal capsule damage IL1B -0.38 rs16944 A G SNV 0.04000000 3.710
May et al., 2021 CP Birth asphyxiia, intravascular hemorrhage; right side hemiparesis, spasticity, dystonia GNAO1 -0.74 NM_138736.3:c.662C>A C A SNV None None
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.3715G>A C T SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs879253888 G A SNV None None
Calkavur et al., 2011 NESHIE Negative neurological findings IL6 0.73 rs1800795 C G SNV 0.04000000 None
Gibson et al., 2007 CP Protective for preterm birth NOS3 -1.10 rs1800779 G A SNV 0.01200000 None
Moreno-De-Luca et al., 2021 CP None PHIP -1.24 NM_017934.7:c.3782+2AAGT>- None None None None None
May et al., 2021 CP Birth asphyxia; spastic quadriparesis, left-sided hemiparesis COL4A1 -2.82 NM_001845:c.2263G>A C T SNV None None
Calkavur et al., 2011 NESHIE Abnormal electroencephalogram IL6 0.73 rs1800795 C G SNV 0.04000000 None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1554286 A T SNV 0.03900000 None
Hou et al., 2016 CP None TNF -0.03 rs1799724 C T SNV 0.03400000 None
van Eyk et al., 2019 CP Male, spastic quad, born 40 weeks, partial dysgenesis of corpus callosum, global DD, Ep (first seizure at 12 months), optic atrophy (cortically blind); type 1 diabetes, scoliosis in the lumbar region and an oblique pelvis, incontinent of faeces and urine, cortical atrophy has been progressive. KIF1A -3.67 rs387906799 G A SNV None None
Woodward et al., 2023 NESHIE None CDKL5 -0.67 CDKL5:c.2388_2404DEL None None DEL None None
Gabriel et al., 2016 NESHIE Periventricular leukomalacia IL1B -0.38 rs16944 A G SNV 0.00300000 23.120
Kuzmanic Samija et al., 2014 NESHIE Low Apgar scores NOS3 -1.10 rs1808593 G T SNV 0.01500000 10.400
Moreno-De-Luca et al., 2021 CP None SMARCB1 -0.34 NM_00307:c.110G>A None None SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs1553638614 C T SNV None None
Esih et al., 2021_2 NESHIE Higher epilepsy risk only in carriers of at least one polymorphic CARD8 rs2043211 IL1B -0.38 rs16944 A G SNV 0.04400000 13.330
Chen et al., 2019 NESHIE None AGT 0.49 rs2067853 G A SNV 0.04300000 None
Gabriel et al., 2016 NESHIE Reduced periventricular leukomalacia risk IL10 0.04 rs1800896 T C SNV 0.03000000 0.510
Wang et al., 2024 CP None GNAO1 -0.74 NM_138736.3:c.788C>T C T SNV None None
Esih et al., 2021 NESHIE Protective against cortex damage CARD8 1.18 rs2043211 A T SNV 0.03100000 0.150
Moreno-De-Luca et al., 2021 CP None ZDHHC9 -0.12 NM_016032.4:c.777+1G>A C T SNV None None
van Eyk et al., 2019 CP Spastic hemiplegia, periventricular leukomalacia COL4A1 -2.82 NM_001303110.1:c.136G>A C T SNV None None
Thys et al., 2024 CP Spastic diplegia, epilepsy, Intellectual disability, Developmental disorder KIF1A -3.67 NM_001244008.2:c.641G>C C G SNV None None
Moreno-De-Luca et al., 2021 CP None SCN1A -1.43 NM_001165963:c.4441G>A C T SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs1553639041 G T SNV None None
Mei et al., 2021 CP None KCNQ2 -0.67 NM_172107.4:c.2326delC CG C DEL None None
Esih et al., 2021_2 NESHIE Lower epilepsy risk in carriers of two normal IL1B rs16944 alleles CARD8 1.18 rs2043211 A T SNV 0.01900000 0.030
Kremer and Grosso, 2004 NESHIE Associated with mothers of affected children with CP MTHFR 0.09 rs1801133 G A SNV <0.05000000 None
Gibson et al., 2008 CP Girls MTHFR 0.09 rs1801133 G A SNV 0.00900000 1.740
van Eyk et al., 2019 CP Spastic hemiplegia COL4A1 -2.82 NM_001845.6:c.4516A>G T C SNV None None
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.470T>C T C SNV None None
Matthews et al., 2019 CP Intellectual disability, evidence of findings not typical of classical CP (stroke, brain iron accumulation, atypical white matter lesions of other structural findings) GNAO1 -0.74 rs79704487 G T SNV None None
Pavelekova et al., 2023 CP None AUTS2 -1.97 rs1585653240 A C SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs3024490 A T SNV 0.02700000 None
Wu et al., 2009 CP None IL6 0.73 rs1800795 C G SNV 0.02000000 1.600
Gabriel et al., 2016 NESHIE Periventricular leukomalacia IL1B -0.38 rs16944 A G SNV 0.00300000 23.120
Moreno-De-Luca et al., 2021 CP None SCN1A -1.43 NM_001165963:c.2628A>T T A SNV None None
Moreno-De-Luca et al., 2021 CP None AUTS2 -1.97 NM_015570:c.1297_1300CCT None None None None None
Thys et al., 2024 CP Developmental disorder, axial hypotonia, Intellectual disability, quadriplegia GNAO1 -0.74 rs797044951 G A SNV None None
Thys et al., 2024 CP Spastic hemiplegia, congenital cataract, vision problems, Intellectual disability, epilepsy, Autism spectrum disorder COL4A1 -2.82 rs2139162750 C T SNV None None
Chopra et al., 2022 CP Spastic, non-cryptogenic (predefined risk factors) COL4A1 -2.82 NM_001845.4:c.443G>A C T SNV None None
Esih et al., 2021 NESHIE Moderate to severe magnetic resonance imaging presentation IL1B -0.38 rs1143623 C G SNV 0.04000000 3.780
van Eyk et al., 2021 CP Spastic quadriplegia, seizures, epilepsy, developmental delay SCN1A -1.43 NM_001165963.4:c.2522C>T C T SNV None None
Moreno-De-Luca et al., 2021 CP None PTPN11 -0.43 rs397507520 G C SNV None None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1518111 T C SNV 0.01800000 None
Cheng et al., 2011 CP Mental retardation MTHFR 0.09 rs1801131 T G SNV 0.01400000 None
Woodward et al., 2023 NESHIE None SCN9A 0.33 SCN9A:c.4652G>A None None SNV None None
Moreno-De-Luca et al., 2021 CP None GNAO1 -0.74 NM_020988:c.736G>A G A SNV None None
Sun et al., 2019 CP NESHIE OLIG2 None rs6517135 T C SNV 0.00300000 0.558
Woodward et al., 2023 NESHIE None KCNQ2 -0.67 rs727503974 G A SNV None None
Gabriel et al., 2016 NESHIE Reduced periventricular leukomalacia risk IL1B -0.38 rs16944 A G SNV 0.00300000 0.043
Woodward et al., 2023 NESHIE None KIF1A -3.67 rs373882732 C G SNV None None
Esih et al., 2021 NESHIE Protective against brainstem damage CARD8 1.18 rs2043211 A T SNV 0.02000000 0.070
Sun et al., 2019 CP NESHIE OLIG2 None rs6517135 T C SNV 0.00700000 None
Gabriel et al., 2016 NESHIE Periventricular leukomalacia TNF -0.03 rs1799964 T C SNV 0.04400000 2.471
Wu et al., 2011 CP None IL6 0.73 rs1800795 C G SNV 0.00200000 1.720
May et al., 2021 CP Birth asphyxia, intravascular stroke/hemorrhage; spastic bilateral CP SCN1A -1.43 NM_006920.6:c.2492_2495delGTTC GTTC - SNV None None
Mei et al., 2021 CP None CDKL5 -0.67 NM_003159.3:c.1730_1731dupTG A ATG INS None None
Fehlings et al., 2024 CP Unspecified CP Subtype, Down Syndrome, normal MRI, congenital malformation, prenatal growth restriction, intrapartum birth asphyxia, intrauterine infection, multiple fetuses, prolonged preterm premature rupture of membrane, family history of CP, prematurity AUTS2 -1.97 NM_015570.4:c.690+63379A>G A G SNV None None
Wu et al., 2009 CP Controlling for race; male sex IL6 0.73 rs1800795 C G SNV 0.02000000 1.500
Thys et al., 2024 CP Spastic diplegia, Developmental disorder, Intellectual disability, behavior KIF1A -3.67 rs797045050 C T SNV None None
Wang et al., 2024 CP None AUTS2 -1.97 NM_015570.4:c.1864_1865insCTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT G CTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT INS None None
van Eyk et al., 2019 CP Spastic/dystonic diplegia, neonatal encephalopathy, developmental delay, seizure, cerebral oedema KANK1 -0.92 NM_153186.5:c.2398G>A G A SNV None None
van Eyk et al., 2021 CP Spastic hemiplegia COL4A1 -2.82 NM_001845.6:c.4114G>C C G SNV None None
Bi et al., 2014 CP Periventricular leukomalacia IL6 0.73 rs1800796 G C SNV 0.04200000 None
Gibson et al., 2006 CP Hemiplegia, gestational age < 32 weeks TNF -0.03 rs1800629 G A SNV 0.03000000 2.380
van Eyk et al., 2019 CP Spastic quadriplegia, diagnosed neonatal encephalopathy, watershed and cerebral cortex brain injury DYNC2H1 -0.35 NM_001377:c.A9862T A T SNV None None
Calkavur et al., 2011 NESHIE None IL6 0.73 rs1800795 C G SNV None 4.180
Hou et al., 2016 CP None TNF -0.03 rs361525 G A SNV 0.00700000 None
van Eyk et al., 2019 CP Spastic quadriplegia with generalised hypotonia, dystonic posture, intellectual disability, epilepsy, periventricular leukomalacia COL4A1 -2.82 NM_001845.6:c.2413G>A C T SNV None None
Chen et al., 2013 CP Spastic tetraplegia in males IL6 0.73 rs2069837 A G SNV 0.03500000 1.580
Wu et al., 2011 CP None IL6 0.73 rs1800795 C G SNV <0.00100000 1.790
May et al., 2021 CP Birth asphyxia; spastic SMARCB1 -0.34 NM_003073.5:c.1121G>A G A SNV None None
van Eyk et al., 2019 CP Spastic diplegia, mild dystonia, epilepsy, developmental delay DYNC2H1 -0.35 NM_001080463.1:c.6916T>C T C SNV None None
Almansa et al., 2024 CP None GNAO1 -0.74 rs886039494 C T SNV None None
Moreno-De-Luca et al., 2021 CP None KIF1A -3.67 rs672601370 G A SNV None None
Varner et al., 2023 CP Associated with the combined outcome of CP or death IL1B -0.38 rs3136558 A G SNV 0.00270000 None
Xia et al., 2018 CP Spastic tetraplegia IL10 0.04 rs1800896 T C SNV 0.03000000 None
van Eyk et al., 2021 CP Spastic quadriplegia, seizures, epilepsy, developmental delay SCN1A -1.43 NM_001165963.4: c.2522C>T C T SNV None None
Bi et al., 2016 CP None COL4A1 -2.82 rs1411040 C T SNV 0.04850000 1.746
Fehlings et al., 2024 CP Spastic diplegic CP with normal MRI, intrapartum birth asphyxia, maternal illness: first and second trimester, vaginal bleeding GNAO1 -0.74 NM_138736.3:c.711A>C A C SNV None None
Pingel et al., 2018 CP None COL4A4 1.04 rs190148408 G C SNV None None
Mei et al., 2021 CP None SCN1A -1.43 NM_001165963.4:c.4529C>T G A SNV None None
van Eyk et al., 2021 CP Asymmetric spastic diplegia, developmental delay, seizures COL4A1 -2.82 NM_001303110.2:c.1258G>A C T SNV None None
van Eyk et al., 2019 CP Spastic/dystonic quadriplegia KANK1 -0.92 NM_153186.5:c.3005G>A G A SNV None None
Wang et al., 2024 CP None CDKL5 -0.67 rs267608433 GAAA - SNV None None
Woodward et al., 2023 NESHIE Cystic fibrosis confirmed in patient following genetic testing CFTR -0.51 rs113993960 CTT - DEL None None
Wu et al., 2009 CP Caucasian IL6 0.73 rs1800795 C G SNV 0.03000000 None
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.3497G>A C T SNV None None
McMichael et al., 2015 CP NESHIE EIF4E2 -0.34 NM_004846:c.214C>G C G SNV None None
Pavlov, et al., 2023 NESHIE Higher risk of more severe magnetic resonance imaging findings NOS2 -1.68 rs1137933 G A SNV 0.02800000 7.100
Moreno-De-Luca et al., 2021 CP None COL4A1 -2.82 NM_001845:c.2086G>A C T SNV None None
Moreno-De-Luca et al., 2021 CP None AUTS2 -1.97 rs1554480537 C T SNV None None
Gabriel et al., 2016 NESHIE Periventricular leukomalacia TNF -0.03 rs1799964 T C SNV 0.04300000 2.495
Calkavur et al., 2011 NESHIE None IL6 0.73 rs1800795 C G SNV 0.00200000 None
Parobek et al., 2024 NESHIE None PTPN11 -0.43 rs397507545 G A SNV None None
van Eyk et al., 2019 CP Spastic hemiplegia, periventricular leukomalacia COL4A1 -2.82 NM_001303110.1:c.136G>A C T SNV None None
Pavelekova et al., 2023 CP None PANK2 -0.23 NM_153638.2:c.735dup C CT DUP None None
Gibson et al., 2005 CP Diplegia MTHFR 0.09 rs1801133 G A SNV <0.05000000 1.580
Gibson et al., 2005 CP 32-36 weeks gestation MTHFR 0.09 rs1801133 G A SNV <0.05000000 2.550
Bi et al., 2014 CP Premature rupture of membrane IL6 0.73 rs1800796 G C SNV 0.00180000 None