Study Findings

The Study Findings table contains information on the genetic findings of a particular NESHIE or CP genetic study. Variants with statistically-significant associations with NESHIE or CP have p-values < 0.05. Odds ratio values quantify the strength of association of a variant allele with NESHIE or CP.

Paper: Wang et al., 2024

DOI: 10.1038/s41591-024-02912-z

Study population description: Chinese; 1578 CP patients from the Children's Hospital and Third Affiliated Hospital of Zhengzhou University

Regional classification: East Asia

Sequencing or genotyping methods: Whole exome sequencing (n=1536), whole genome sequencing (n=42)

Variant Reported allele or genotype Condition Condition description Disease status Odds ratio P value
rs267608433 - CP None Not determined None None
NM_015570.4:c.1864_1865insCTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT CTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT allele CP None Not determined None None
NM_001845.6:c.2147del C allele CP None Not determined None None
rs1877827904 A allele CP None Not determined None None
NM_138736.3:c.788C>T T allele CP None Not determined None None
rs539662922 T allele CP None Not determined None None
NM_020988.3:c.164T>A A allele CP None Not determined None None
NM_172107.4:c.881C>T A allele CP None Not determined None None
rs796052622 G allele CP None Not determined None None
rs397515420 C allele CP None Not determined None None
rs879253888 A allele CP None Not determined None None
NM_001244008.1:c.2977+2T>C G allele CP None Not determined None None
rs1057518226 T allele CP None Not determined None None
rs771126523 - CP None Not determined None None
rs1057521746 T allele CP None Not determined None None
rs147540920 A allele CP None Not determined None None
NM_001363711.2:c.2202G>A T allele CP None Not determined None None
rs61753251 - CP None Not determined None None