Variant Effect Prediction


The Variant Effect Prediction table provides variant annotation information, including variant consequences, predicted variant effects and variant allele frequencies. To view live NCBI ALFA allele frequencies for a particular variant, click on the ALFA Frequency link in the table.

Variant Name: NM_015570.4:c.1864_1865insCTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT

Ensembl canonical HGVSC: NM_015570.4:c.1864delinsCTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT

Reference genome: GRCh38

Transcript ID: NC_000007.14

Chromosome: 7

Genomic start position: 70774061

Genomic end position: 70774062

Reference allele: G

Alternate allele: CTGGCCGGCAACGGCACGACGACCGGCACCGCGCGCTATCGCGGCGACAACCTGCTCGACATGAATACGCGCGCGCTGAACGCGGT

Disease association with reference allele: False

Variant type: INS

Gene: AUTS2

Consequence terms Polyphen2 hvar score Polyphen2 hvar prediction SIFT score SIFT prediction SIFT4G score SIFT4G prediction FATHMM score FATHMM prediction CADD raw CADD phred MutationTaster effect prediction MutationTaster query model 1000 Genomes global allele frequency 1000 Genomes allele frequency EUR 1000 Genomes allele frequency AFR 1000 Genomes allele frequency AMR 1000 Genomes allele frequency SAS 1000 Genomes allele frequency EAS ExAC global allele frequency ExAC allele frequency NFE ExAC allele frequency AFR ExAC allele frequency AMR ExAC allele frequency EAS ExAC allele frequency SAS gnomAD global allele frequency gnomAD allele frequency AFR gnomAD allele frequency EAS Live ALFA allele frequency
frameshift_variant None None None None None None None None None None None None None None None None None None None None None None None None None None None No ALFA allele frequency available